ID: 939231777

View in Genome Browser
Species Human (GRCh38)
Location 2:139436051-139436073
Sequence TAATCTGCTCTTAGCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939231777_939231778 8 Left 939231777 2:139436051-139436073 CCAGTTTTGCTAAGAGCAGATTA No data
Right 939231778 2:139436082-139436104 AGAAAACCCTGTTGTAATATAGG No data
939231777_939231780 10 Left 939231777 2:139436051-139436073 CCAGTTTTGCTAAGAGCAGATTA No data
Right 939231780 2:139436084-139436106 AAAACCCTGTTGTAATATAGGGG No data
939231777_939231779 9 Left 939231777 2:139436051-139436073 CCAGTTTTGCTAAGAGCAGATTA No data
Right 939231779 2:139436083-139436105 GAAAACCCTGTTGTAATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939231777 Original CRISPR TAATCTGCTCTTAGCAAAAC TGG (reversed) Intergenic
No off target data available for this crispr