ID: 939231780

View in Genome Browser
Species Human (GRCh38)
Location 2:139436084-139436106
Sequence AAAACCCTGTTGTAATATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939231777_939231780 10 Left 939231777 2:139436051-139436073 CCAGTTTTGCTAAGAGCAGATTA No data
Right 939231780 2:139436084-139436106 AAAACCCTGTTGTAATATAGGGG No data
939231776_939231780 16 Left 939231776 2:139436045-139436067 CCTGTTCCAGTTTTGCTAAGAGC No data
Right 939231780 2:139436084-139436106 AAAACCCTGTTGTAATATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939231780 Original CRISPR AAAACCCTGTTGTAATATAG GGG Intergenic
No off target data available for this crispr