ID: 939232079

View in Genome Browser
Species Human (GRCh38)
Location 2:139441044-139441066
Sequence AGCTACTCGGGAGGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109344
Summary {0: 5, 1: 210, 2: 7956, 3: 41130, 4: 60043}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939232079 Original CRISPR AGCTACTCGGGAGGCCCAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr