ID: 939233907

View in Genome Browser
Species Human (GRCh38)
Location 2:139466899-139466921
Sequence CATTTTAGGGAGGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939233896_939233907 25 Left 939233896 2:139466851-139466873 CCTCAGTCTTCCTTTCTACAATA No data
Right 939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG No data
939233897_939233907 15 Left 939233897 2:139466861-139466883 CCTTTCTACAATATGAGTTGAAT No data
Right 939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939233907 Original CRISPR CATTTTAGGGAGGGGGTGGA AGG Intergenic
No off target data available for this crispr