ID: 939233907 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:139466899-139466921 |
Sequence | CATTTTAGGGAGGGGGTGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
939233896_939233907 | 25 | Left | 939233896 | 2:139466851-139466873 | CCTCAGTCTTCCTTTCTACAATA | No data | ||
Right | 939233907 | 2:139466899-139466921 | CATTTTAGGGAGGGGGTGGAAGG | No data | ||||
939233897_939233907 | 15 | Left | 939233897 | 2:139466861-139466883 | CCTTTCTACAATATGAGTTGAAT | No data | ||
Right | 939233907 | 2:139466899-139466921 | CATTTTAGGGAGGGGGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
939233907 | Original CRISPR | CATTTTAGGGAGGGGGTGGA AGG | Intergenic | ||
No off target data available for this crispr |