ID: 939236075

View in Genome Browser
Species Human (GRCh38)
Location 2:139495231-139495253
Sequence GTCAAATAGAACTAGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939236069_939236075 27 Left 939236069 2:139495181-139495203 CCTTGCAATGAGTATGAGATTCT No data
Right 939236075 2:139495231-139495253 GTCAAATAGAACTAGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939236075 Original CRISPR GTCAAATAGAACTAGGGAAA TGG Intergenic
No off target data available for this crispr