ID: 939237908

View in Genome Browser
Species Human (GRCh38)
Location 2:139521138-139521160
Sequence GCCACAGACTGCAAAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939237907_939237908 10 Left 939237907 2:139521105-139521127 CCTCTCTAGAAGTCTAATATATC No data
Right 939237908 2:139521138-139521160 GCCACAGACTGCAAAGAGCCAGG No data
939237906_939237908 24 Left 939237906 2:139521091-139521113 CCAAGGGTCAGGTTCCTCTCTAG No data
Right 939237908 2:139521138-139521160 GCCACAGACTGCAAAGAGCCAGG No data
939237905_939237908 29 Left 939237905 2:139521086-139521108 CCAGGCCAAGGGTCAGGTTCCTC No data
Right 939237908 2:139521138-139521160 GCCACAGACTGCAAAGAGCCAGG No data
939237904_939237908 30 Left 939237904 2:139521085-139521107 CCCAGGCCAAGGGTCAGGTTCCT No data
Right 939237908 2:139521138-139521160 GCCACAGACTGCAAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939237908 Original CRISPR GCCACAGACTGCAAAGAGCC AGG Intergenic
No off target data available for this crispr