ID: 939240863

View in Genome Browser
Species Human (GRCh38)
Location 2:139558547-139558569
Sequence TTTAGGTTCTTTAGATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939240858_939240863 -1 Left 939240858 2:139558525-139558547 CCCTAGGGAGGCAAAGCTTCCTT No data
Right 939240863 2:139558547-139558569 TTTAGGTTCTTTAGATGTCTGGG No data
939240859_939240863 -2 Left 939240859 2:139558526-139558548 CCTAGGGAGGCAAAGCTTCCTTT No data
Right 939240863 2:139558547-139558569 TTTAGGTTCTTTAGATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939240863 Original CRISPR TTTAGGTTCTTTAGATGTCT GGG Intergenic
No off target data available for this crispr