ID: 939243101

View in Genome Browser
Species Human (GRCh38)
Location 2:139587674-139587696
Sequence GCCCTTAAGGATCACAGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939243101_939243103 -7 Left 939243101 2:139587674-139587696 CCTTAACTGTGATCCTTAAGGGC No data
Right 939243103 2:139587690-139587712 TAAGGGCTTCATGTGTGAAAAGG No data
939243101_939243104 17 Left 939243101 2:139587674-139587696 CCTTAACTGTGATCCTTAAGGGC No data
Right 939243104 2:139587714-139587736 AACAGTCATCCTTGCAAAGATGG No data
939243101_939243105 18 Left 939243101 2:139587674-139587696 CCTTAACTGTGATCCTTAAGGGC No data
Right 939243105 2:139587715-139587737 ACAGTCATCCTTGCAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939243101 Original CRISPR GCCCTTAAGGATCACAGTTA AGG (reversed) Intergenic
No off target data available for this crispr