ID: 939246270

View in Genome Browser
Species Human (GRCh38)
Location 2:139627152-139627174
Sequence TTGTGCATGAAAAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939246267_939246270 5 Left 939246267 2:139627124-139627146 CCAAATAGTAGCAACAATTGGCA No data
Right 939246270 2:139627152-139627174 TTGTGCATGAAAAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939246270 Original CRISPR TTGTGCATGAAAAAGGAGGC TGG Intergenic
No off target data available for this crispr