ID: 939249638

View in Genome Browser
Species Human (GRCh38)
Location 2:139667336-139667358
Sequence CTGATTCAGCAGAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939249638_939249642 24 Left 939249638 2:139667336-139667358 CCTCTCTCCCTCTGCTGAATCAG No data
Right 939249642 2:139667383-139667405 TATTTTCCCCTCAACCTCTCTGG No data
939249638_939249643 25 Left 939249638 2:139667336-139667358 CCTCTCTCCCTCTGCTGAATCAG No data
Right 939249643 2:139667384-139667406 ATTTTCCCCTCAACCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939249638 Original CRISPR CTGATTCAGCAGAGGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr