ID: 939249674

View in Genome Browser
Species Human (GRCh38)
Location 2:139667640-139667662
Sequence CTCGGTTATCAGAAGTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939249674_939249681 25 Left 939249674 2:139667640-139667662 CCCTAGCACTTCTGATAACCGAG No data
Right 939249681 2:139667688-139667710 AGTGAGGAGAATGTTCAAAAGGG No data
939249674_939249680 24 Left 939249674 2:139667640-139667662 CCCTAGCACTTCTGATAACCGAG No data
Right 939249680 2:139667687-139667709 CAGTGAGGAGAATGTTCAAAAGG No data
939249674_939249678 9 Left 939249674 2:139667640-139667662 CCCTAGCACTTCTGATAACCGAG No data
Right 939249678 2:139667672-139667694 TTTTAATTTTTCATCCAGTGAGG No data
939249674_939249682 30 Left 939249674 2:139667640-139667662 CCCTAGCACTTCTGATAACCGAG No data
Right 939249682 2:139667693-139667715 GGAGAATGTTCAAAAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939249674 Original CRISPR CTCGGTTATCAGAAGTGCTA GGG (reversed) Intergenic
No off target data available for this crispr