ID: 939249678

View in Genome Browser
Species Human (GRCh38)
Location 2:139667672-139667694
Sequence TTTTAATTTTTCATCCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939249675_939249678 8 Left 939249675 2:139667641-139667663 CCTAGCACTTCTGATAACCGAGG No data
Right 939249678 2:139667672-139667694 TTTTAATTTTTCATCCAGTGAGG No data
939249677_939249678 -9 Left 939249677 2:139667658-139667680 CCGAGGATTTTATTTTTTAATTT No data
Right 939249678 2:139667672-139667694 TTTTAATTTTTCATCCAGTGAGG No data
939249674_939249678 9 Left 939249674 2:139667640-139667662 CCCTAGCACTTCTGATAACCGAG No data
Right 939249678 2:139667672-139667694 TTTTAATTTTTCATCCAGTGAGG No data
939249673_939249678 12 Left 939249673 2:139667637-139667659 CCTCCCTAGCACTTCTGATAACC No data
Right 939249678 2:139667672-139667694 TTTTAATTTTTCATCCAGTGAGG No data
939249672_939249678 18 Left 939249672 2:139667631-139667653 CCATTTCCTCCCTAGCACTTCTG No data
Right 939249678 2:139667672-139667694 TTTTAATTTTTCATCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939249678 Original CRISPR TTTTAATTTTTCATCCAGTG AGG Intergenic
No off target data available for this crispr