ID: 939249680

View in Genome Browser
Species Human (GRCh38)
Location 2:139667687-139667709
Sequence CAGTGAGGAGAATGTTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939249673_939249680 27 Left 939249673 2:139667637-139667659 CCTCCCTAGCACTTCTGATAACC No data
Right 939249680 2:139667687-139667709 CAGTGAGGAGAATGTTCAAAAGG No data
939249677_939249680 6 Left 939249677 2:139667658-139667680 CCGAGGATTTTATTTTTTAATTT No data
Right 939249680 2:139667687-139667709 CAGTGAGGAGAATGTTCAAAAGG No data
939249674_939249680 24 Left 939249674 2:139667640-139667662 CCCTAGCACTTCTGATAACCGAG No data
Right 939249680 2:139667687-139667709 CAGTGAGGAGAATGTTCAAAAGG No data
939249675_939249680 23 Left 939249675 2:139667641-139667663 CCTAGCACTTCTGATAACCGAGG No data
Right 939249680 2:139667687-139667709 CAGTGAGGAGAATGTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939249680 Original CRISPR CAGTGAGGAGAATGTTCAAA AGG Intergenic
No off target data available for this crispr