ID: 939249682

View in Genome Browser
Species Human (GRCh38)
Location 2:139667693-139667715
Sequence GGAGAATGTTCAAAAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939249674_939249682 30 Left 939249674 2:139667640-139667662 CCCTAGCACTTCTGATAACCGAG No data
Right 939249682 2:139667693-139667715 GGAGAATGTTCAAAAGGGACTGG No data
939249677_939249682 12 Left 939249677 2:139667658-139667680 CCGAGGATTTTATTTTTTAATTT No data
Right 939249682 2:139667693-139667715 GGAGAATGTTCAAAAGGGACTGG No data
939249675_939249682 29 Left 939249675 2:139667641-139667663 CCTAGCACTTCTGATAACCGAGG No data
Right 939249682 2:139667693-139667715 GGAGAATGTTCAAAAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939249682 Original CRISPR GGAGAATGTTCAAAAGGGAC TGG Intergenic
No off target data available for this crispr