ID: 939255078

View in Genome Browser
Species Human (GRCh38)
Location 2:139732871-139732893
Sequence CTGCAGGTTCAGATGAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939255078 Original CRISPR CTGCAGGTTCAGATGAGGCT AGG (reversed) Intergenic
900206074 1:1432416-1432438 CTGCAGGGGCAGAGCAGGCTGGG - Intergenic
900659642 1:3776186-3776208 CTGCAGCTCCTGCTGAGGCTGGG - Intergenic
900744074 1:4349139-4349161 CAGTAGGTTGAGAGGAGGCTAGG + Intergenic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
902687102 1:18085311-18085333 CTGCAGGCTCAGCTGAGGATTGG + Intergenic
902705698 1:18202733-18202755 TTACAGGTTGAGATGAGACTTGG + Intronic
903427185 1:23262697-23262719 TGGCAGGTTCACTTGAGGCTAGG + Intergenic
903731830 1:25502111-25502133 ATGCAGATTCAGATGGGTCTGGG - Intergenic
903957939 1:27037994-27038016 CCCCAGGTTCTGATGAGGCCAGG - Intergenic
904046067 1:27609229-27609251 CTGAGGGTGCAGATGAGGCATGG - Intergenic
905072351 1:35238105-35238127 CTGCAGTTTCAGACTAGCCTGGG + Intergenic
905590787 1:39161474-39161496 CAGGAGGATCAGTTGAGGCTAGG + Intronic
905669724 1:39783678-39783700 CAGGAGGATCAGATGAGGCCAGG + Intronic
907674467 1:56506060-56506082 CTGCAGGGCCAGAAGAGGTTTGG + Intronic
908597615 1:65705431-65705453 ATGCAGGTTCAGCAGATGCTGGG - Intergenic
909047664 1:70729433-70729455 CTGCAGTTTCAAATGAGACCAGG + Intergenic
909357170 1:74723157-74723179 CTCCTGGCTCAGATGTGGCTGGG - Exonic
913017150 1:114750143-114750165 CTTCAAGTTCAGATCAGGCAAGG - Exonic
913289807 1:117261660-117261682 CTGGAGGGCAAGATGAGGCTGGG + Intergenic
913475049 1:119229194-119229216 CTGAAGGTGCATATGAGGATGGG - Intergenic
916706680 1:167357585-167357607 CTGGAGTTTGAGATGAGCCTGGG - Intronic
916733762 1:167589181-167589203 CTTTACGTTCAGATGTGGCTGGG + Intergenic
917286320 1:173425070-173425092 CTGCAGGGTCATATGTGGCTGGG - Intergenic
919904466 1:202068563-202068585 CTGCAGATTCAGAGTAGCCTGGG - Intergenic
920188184 1:204175364-204175386 CTGCAGGGTGAGGTGAGACTTGG + Intergenic
920336635 1:205249445-205249467 CTGCTGGTTCAGAGGTGGGTGGG + Intronic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920952576 1:210586213-210586235 CAGGAGGTTCACTTGAGGCTAGG + Intronic
923368550 1:233287360-233287382 CTGCAGTTTAAGATGAGATTTGG - Intronic
923537521 1:234864427-234864449 CAGCAGGATCAGTTGAGGCCAGG + Intergenic
1063341485 10:5269045-5269067 CTGAAGGTTCAGATGACTATTGG - Intergenic
1063491505 10:6467977-6467999 CTGGAGGTTCACTTGAGCCTAGG + Intronic
1065148376 10:22796568-22796590 CAGCAGTTTCAGATCAGCCTGGG - Intergenic
1065906905 10:30263038-30263060 CTGCAATTTCAGATGAGATTTGG - Intergenic
1066028028 10:31384727-31384749 CTGCAGGTGGAAATGAGGCAAGG + Intronic
1066189070 10:33038729-33038751 CTGGAGGATCAGTTGAGGCCAGG + Intergenic
1067012556 10:42728008-42728030 CTGGAGGGTCAGCTGAGGCCAGG + Intergenic
1067285606 10:44905561-44905583 CTGAAGGTTCAACTGGGGCTGGG + Intergenic
1067311035 10:45113880-45113902 CTGGAGGGTCAGCTGAGGCCAGG - Intergenic
1068141413 10:53012787-53012809 CTGCATTTTCATCTGAGGCTTGG - Intergenic
1068194518 10:53698757-53698779 CTACAAGTTCACCTGAGGCTTGG + Intergenic
1068677208 10:59780342-59780364 CTGCAGGGTCAGAACAAGCTTGG - Intergenic
1069099365 10:64299402-64299424 CAGGAGGTTGAGATGAGCCTGGG + Intergenic
1069148229 10:64922827-64922849 TGGGAGGTTCACATGAGGCTAGG + Intergenic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1069720392 10:70545804-70545826 CTGCAGGTTAGGAGGAGGGTGGG + Intronic
1069736264 10:70656709-70656731 CTCATAGTTCAGATGAGGCTGGG + Intergenic
1070672612 10:78388608-78388630 CTGCAGGTTTAGACAAGGCTTGG + Intergenic
1070957380 10:80473453-80473475 ATGCAGGTGCAGGAGAGGCTGGG - Intronic
1072416138 10:95248473-95248495 CTGGAGGATCACTTGAGGCTGGG - Intronic
1072941515 10:99768356-99768378 CAGCAGTTTGAGATGAGCCTGGG + Intergenic
1073007900 10:100338814-100338836 CTGCAGGTTCAGATCTGGGCCGG + Intergenic
1075062205 10:119265045-119265067 ATACAGGTTAAGATGAGGCAAGG - Intronic
1075325735 10:121530924-121530946 CTGGAGATTCAGGTGAGGATGGG - Intronic
1075595654 10:123727294-123727316 CTGGAGGGAGAGATGAGGCTGGG - Intronic
1076621716 10:131793154-131793176 CTGTTGGATCAGAGGAGGCTTGG + Intergenic
1076825319 10:132964325-132964347 CTGCAGGTGGAGAGGAGGCAAGG + Intergenic
1077336873 11:2009266-2009288 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1080645091 11:34182384-34182406 CTGCTGGAGGAGATGAGGCTGGG - Intronic
1080738547 11:35041790-35041812 CAGCAGGTTTAGGTGAGACTAGG + Intergenic
1081926269 11:46831619-46831641 CAGGAGGCTCACATGAGGCTGGG - Intronic
1083386188 11:62312126-62312148 CAGGAGTTTGAGATGAGGCTGGG - Intergenic
1083841760 11:65308790-65308812 CTGCAGGCTGAGCTTAGGCTGGG + Intergenic
1084052932 11:66612733-66612755 CTGGAGGATCACTTGAGGCTAGG + Intergenic
1084954201 11:72682932-72682954 CTGCAGGTGAAGGGGAGGCTGGG - Intergenic
1085616908 11:78007208-78007230 GTGAAGGTTCAGATGATGGTTGG + Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1088229959 11:107663415-107663437 CAGCAGGATCACATGAGGCCAGG + Intronic
1088494073 11:110416307-110416329 CAGGAGGATCACATGAGGCTAGG - Intergenic
1088550635 11:111009327-111009349 CTGCAGGTGGAGACGGGGCTTGG + Intergenic
1088750421 11:112837918-112837940 CTTCGGGTACAGATGAGGCCAGG + Intergenic
1088809160 11:113378420-113378442 TTGCAGGTTTAGAGGAGCCTTGG - Intronic
1089250046 11:117152624-117152646 CTGCAGTTTGAGATCAGCCTGGG - Intronic
1090119410 11:124009215-124009237 CTGCAATTTCATTTGAGGCTTGG - Intergenic
1091241441 11:134055103-134055125 CCGCAGGGTCGGCTGAGGCTGGG - Intergenic
1202819857 11_KI270721v1_random:64448-64470 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1091395540 12:152233-152255 CTGCAGGTTCAGAGCTGGCCTGG - Intronic
1091413771 12:262251-262273 CTGTAGAGTCAGATGAGGCCAGG + Intronic
1093784586 12:23177389-23177411 CTGCATCTGAAGATGAGGCTGGG - Intergenic
1095602772 12:44032952-44032974 GGGCAGGTTAAAATGAGGCTGGG + Intronic
1096245053 12:49980042-49980064 CTGCAGTTTCTAATGAGGCCTGG + Intronic
1096681222 12:53256659-53256681 CAGGAGTTTCAGATGAGCCTGGG - Intergenic
1097611385 12:61825539-61825561 CTGCACTTTCAGATGAGTGTTGG + Intronic
1097799745 12:63900583-63900605 CGGGAGGATCAGATGAGGCCAGG + Intronic
1098256854 12:68625624-68625646 TTAAAGTTTCAGATGAGGCTGGG + Intronic
1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG + Intronic
1099933721 12:89101582-89101604 CTGGAGGTTGAGTGGAGGCTTGG - Intergenic
1100240147 12:92703065-92703087 CTGCGGGTTCTGAGGAGCCTCGG + Exonic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101599312 12:106195119-106195141 CTCCAGTTTCACATGAGACTTGG - Intergenic
1101834538 12:108286291-108286313 CTGCAGCCTCAGATGAGCCATGG - Intergenic
1101986304 12:109450269-109450291 TTGCAGGTGCAGAGGAGCCTGGG + Exonic
1102261537 12:111446210-111446232 CTGCAGGGTCAGTTGAGACCTGG + Intronic
1102381236 12:112468522-112468544 TCCCAGGTGCAGATGAGGCTGGG + Intronic
1104469659 12:129019271-129019293 CTATTGGTTCAGATGGGGCTTGG - Intergenic
1104566971 12:129893998-129894020 CACCAGCATCAGATGAGGCTGGG + Intronic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1106962052 13:35010347-35010369 CAGGAGGATCACATGAGGCTAGG + Intronic
1108844868 13:54665811-54665833 CTGAAGGTTCACATGATACTTGG - Intergenic
1109228440 13:59725559-59725581 CTGCAAGTTCAGAAGTGCCTTGG - Intronic
1110393169 13:74999501-74999523 GTGTAGGTTGGGATGAGGCTGGG + Intergenic
1110427029 13:75380172-75380194 TAGAAGGGTCAGATGAGGCTAGG - Intronic
1111940568 13:94602187-94602209 CTGGAGGTCCAGGTGAGGCTGGG - Intronic
1113625460 13:111793064-111793086 CTGCAGGTACAAGAGAGGCTGGG - Intergenic
1114541483 14:23463346-23463368 CTGCAGGATCACTTGAGGCAGGG + Intergenic
1116476015 14:45340405-45340427 CTGAAGGTTCAGATGATCATTGG - Intergenic
1117300833 14:54425467-54425489 CTGTGGGTTCAGCTGAGGCATGG - Exonic
1117806440 14:59496593-59496615 TTACAGGTGCAGATGAGGGTTGG - Intronic
1119682699 14:76604806-76604828 CTCCCAGTTCAGATGGGGCTTGG + Intergenic
1121910526 14:97787166-97787188 CTGAAGGCTCAGATGATCCTTGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1123223215 14:106875649-106875671 GAGCAGGTGCACATGAGGCTGGG - Intergenic
1123481960 15:20640540-20640562 GAGCAGGTTCACAGGAGGCTGGG - Intergenic
1123999751 15:25745511-25745533 CAGCAGTTTGAGATGAGCCTGGG + Intronic
1124018860 15:25902110-25902132 CTGCAGGCTCATCTGAGGCTGGG - Intergenic
1124237910 15:28005409-28005431 CTGCAGGACCAGAGGAGGGTGGG - Intronic
1124552030 15:30690396-30690418 CTGCAGCTTCAGATGGCGCCTGG - Intronic
1124679213 15:31715276-31715298 CTGCAGCTTCAGATGGCGCCTGG + Intronic
1124797401 15:32795230-32795252 CTGGGGGTTCAGGTGAGGCAAGG + Intronic
1127827392 15:62716822-62716844 CTGGAGGTGGAGATTAGGCTTGG + Intronic
1128299604 15:66557694-66557716 CTGCAGTTTAAAATGAGACTGGG + Intronic
1129207320 15:74044869-74044891 CTGCAGGTTGAAAGCAGGCTGGG - Exonic
1129615141 15:77092960-77092982 CTGGAGGATCACTTGAGGCTAGG - Intergenic
1130605921 15:85316650-85316672 CTTCTGGTTGAGATGAAGCTTGG - Intergenic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG + Intergenic
1131031444 15:89189255-89189277 CTGGAGGATCACATGAGGCAAGG + Intronic
1132087566 15:98920929-98920951 TTGCAGGTTCGGCTGACGCTCGG - Intronic
1132345375 15:101105051-101105073 CTGCAGGATCACTTGAGGCTAGG - Intergenic
1132686274 16:1163434-1163456 CTGCGGCTTCAGAGGGGGCTGGG - Intronic
1132743520 16:1427513-1427535 CTGCGGTTTCTGGTGAGGCTGGG - Intergenic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133698160 16:8284716-8284738 CAGGAGCTGCAGATGAGGCTGGG + Intergenic
1135859736 16:26044732-26044754 CTGCAGGTTGGGATGATGCTTGG + Intronic
1137883969 16:52082231-52082253 AAGCAGGTTCAGAGGAGGGTGGG - Intergenic
1138502778 16:57458362-57458384 CTGCAGGCCCACAGGAGGCTGGG + Intronic
1138623788 16:58232935-58232957 CTGGAGGATCACCTGAGGCTAGG + Intronic
1139563053 16:67755974-67755996 CTGCTGGTTCAAATGTGGCTTGG - Intronic
1140706288 16:77633282-77633304 CAGGAGGATCAGTTGAGGCTAGG + Intergenic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1141657224 16:85422705-85422727 CTGCAGGTGCAGAAGCCGCTTGG + Intergenic
1142389710 16:89791179-89791201 CTGCATGTTCCGAGGAGCCTGGG - Intronic
1142679904 17:1540989-1541011 CTGGAGGATCATTTGAGGCTGGG - Intronic
1143039135 17:4019663-4019685 CTGGAGGTTCAGAAGAGGTAAGG - Exonic
1143116902 17:4586057-4586079 CTACTGGTGCAGATGAGGGTGGG + Intronic
1143602921 17:7960882-7960904 CTTGAGGTTCAGCTGATGCTGGG + Intergenic
1144042118 17:11421299-11421321 CTGCAGATTCAGCAGAGGCATGG + Intronic
1144737970 17:17565440-17565462 CTCCCGGTTCAGAAGATGCTGGG - Intronic
1144740042 17:17576651-17576673 CTGCAGGTTCTTGTGAGGGTAGG + Intronic
1145915580 17:28571851-28571873 CTCCATTTTCAGATGAGCCTCGG - Exonic
1146301772 17:31695084-31695106 CTGGAGGATCACTTGAGGCTGGG + Intergenic
1147583490 17:41639416-41639438 CTCCAGGGGCAGATGAGGCCAGG + Intergenic
1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG + Intergenic
1150058560 17:62042920-62042942 CTGGAGGATCACTTGAGGCTAGG + Intronic
1152299043 17:79484819-79484841 CAGCAGGCTCAGAGGAGGCTAGG - Intronic
1152983349 18:299682-299704 CTGGAGGTTCAGATGGCCCTTGG - Intergenic
1155870418 18:31020259-31020281 CTGCAGGATGAGAAGAGCCTCGG + Intronic
1156094195 18:33509967-33509989 GTGCAGGTTGAGATGAGGGGAGG - Intergenic
1156465177 18:37344166-37344188 CTGCAGGGTAGGATGGGGCTGGG + Intronic
1157403887 18:47407786-47407808 TTGAAGGATCAGGTGAGGCTTGG - Intergenic
1157479614 18:48045084-48045106 CTGCAGGTTCAGAGGTGCTTAGG + Intronic
1158705278 18:59787013-59787035 CTGCTGGTGGAGATGAGGCTTGG - Intergenic
1159867097 18:73719000-73719022 CTGCAGTTTGAGATCAGCCTGGG - Intergenic
1160143438 18:76346613-76346635 GTGCAGGCTCAGCTGAGGCCAGG - Intergenic
1161391268 19:4022036-4022058 CTGCAGGTCCAGATTGGGCATGG - Intronic
1161679957 19:5675063-5675085 CTGCAAGGTGAGATGAGGCAGGG + Intronic
1161851147 19:6738780-6738802 CTGCAGCCTCAGACAAGGCTGGG - Intronic
1162902107 19:13801241-13801263 CTTCAGGTCCAGATGGGGTTGGG + Intronic
1162955716 19:14096885-14096907 CTGAGGGTTCAGATGAGGGGTGG - Intronic
1163169908 19:15523965-15523987 CAGGAGGATCACATGAGGCTGGG + Intronic
1163662904 19:18589183-18589205 CTGCAGAGTCAGATGGGGCGGGG + Intronic
1164145072 19:22507449-22507471 CTGGAGTTTCAGAGCAGGCTGGG - Intronic
1164793643 19:31008795-31008817 CTGGAGTTTCAGATCAGGCTGGG - Intergenic
1166196150 19:41207149-41207171 CTGCAGTTGCAGAGGTGGCTGGG - Exonic
1166400132 19:42472544-42472566 CAGCAGTTTCAGACGAGCCTGGG - Intergenic
1168343581 19:55640115-55640137 CTGCAGGTGCAGCTGAGAGTGGG - Intronic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
925173643 2:1767600-1767622 CTGCAGGTCCGCCTGAGGCTGGG - Intergenic
925380057 2:3418621-3418643 GTGCAGGTGCACACGAGGCTGGG + Intronic
925716506 2:6788845-6788867 TTGCAATTTCAGATGAGGTTTGG - Intergenic
927150143 2:20190929-20190951 CTTCAGGCACAGATGAGACTTGG - Intergenic
927917619 2:26947062-26947084 CTGCAGGGGCAGGAGAGGCTGGG + Exonic
928306276 2:30172674-30172696 CGGCAGATCCAGTTGAGGCTGGG - Intergenic
928405391 2:31010719-31010741 TTGCAGGTTCTGATCAGGCAGGG - Intronic
928850082 2:35734746-35734768 CTGCTGGCTCTGAAGAGGCTGGG + Intergenic
929297330 2:40263202-40263224 CTGCAGGTGAAGCTGAGGCTTGG - Intronic
931290818 2:60871667-60871689 TGGCAGGATCAGTTGAGGCTAGG - Intergenic
933899356 2:86837948-86837970 CTGGAAGTTCACATGGGGCTGGG - Intronic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
935781206 2:106511280-106511302 CTGGAAGTTCACATGGGGCTGGG + Intergenic
935978649 2:108605020-108605042 CTGCAGCTGCAGGTGAGGCTAGG - Intronic
937702824 2:124883004-124883026 CTACAGTTTAAGATGAGGTTTGG + Intronic
938241391 2:129744858-129744880 CTGCAGGTGGAGCTCAGGCTTGG - Intergenic
938251766 2:129821290-129821312 GTGCAGGTGAAGACGAGGCTGGG - Intergenic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
940517139 2:154697425-154697447 CTGCAGGCTCAACTGAGGCTCGG + Intergenic
946289548 2:218733710-218733732 CTGCAGCTTCTGAGGAGGGTAGG + Intronic
946404497 2:219485095-219485117 CAGCAGGTGCAGAGGAGGGTGGG + Intronic
947442941 2:230139352-230139374 CTGGAGGATCACTTGAGGCTGGG - Intergenic
947561811 2:231160981-231161003 CGGGAGGATCATATGAGGCTAGG + Intronic
948769853 2:240246056-240246078 CTGCAGCTTCAGCCGAGCCTCGG - Intergenic
1170501719 20:16981549-16981571 CTGCAGGATGAGCAGAGGCTGGG + Intergenic
1171117990 20:22543491-22543513 ATGCTGGTTCAGATGAAGTTTGG + Intergenic
1171367387 20:24634968-24634990 CTGCAGGATCCGATGATGCCTGG - Intronic
1172194268 20:33081475-33081497 GTGCAGATGCAGATGTGGCTGGG - Intronic
1173512242 20:43639308-43639330 CAGGAGGATCAGTTGAGGCTGGG + Intronic
1176153234 20:63604136-63604158 CTGGAGGATCACATGAGGCCAGG + Intronic
1178309934 21:31521506-31521528 CGGGAGGATCACATGAGGCTAGG + Intronic
1179392525 21:41006912-41006934 CTGCAGCTTCAGACAAGGATGGG - Intergenic
1179478879 21:41665419-41665441 CTGCAGGCTCAGACAGGGCTGGG + Intergenic
1180250330 21:46582014-46582036 CTGCTGGTTCTGAAGAGGCTGGG - Intergenic
1180940550 22:19657542-19657564 CTGCAGGGGGACATGAGGCTGGG + Intergenic
1181624088 22:24111215-24111237 GAGCATGTTTAGATGAGGCTGGG - Intronic
1183068429 22:35379796-35379818 CTGGAGGTTCACTTGAGCCTGGG - Intergenic
1183733479 22:39630952-39630974 CCGCAGGTTCAGGTGTGGCAGGG + Intronic
1184678174 22:46054518-46054540 ATGGAGGTGCAGAGGAGGCTGGG - Intronic
950902839 3:16513106-16513128 CTGCAGGCTCAGAAGCGCCTAGG - Intronic
950989007 3:17411180-17411202 CTGAAGGCTCAGATGATCCTTGG + Intronic
951047952 3:18062435-18062457 TTGCAGGGTCAGGTGAGGCCAGG + Intronic
952258247 3:31714018-31714040 CTGAAGATTCTGAGGAGGCTGGG + Intronic
952353405 3:32562430-32562452 CAGAAGGTTCATATGAGCCTGGG - Intronic
952968054 3:38633131-38633153 CTGCAGGTCCAGCTGGGGCCGGG + Exonic
953057679 3:39401233-39401255 CTGGAGGATCACTTGAGGCTAGG - Intergenic
954381324 3:50220724-50220746 CAGCAGGTTCTGCTGAGGGTGGG + Exonic
954783305 3:53075694-53075716 ATGAAGGTTAAGATGATGCTGGG - Intronic
956141903 3:66154689-66154711 CAGCAGTTTGAGATGAGCCTGGG - Intronic
956442790 3:69296478-69296500 CTGGAAGTTCAGAATAGGCTGGG + Intronic
956877372 3:73476828-73476850 CTGAAGGCTCAGCTGAGGGTCGG - Intronic
957015309 3:75056280-75056302 CTGGAGGATCACTTGAGGCTAGG + Intergenic
957822437 3:85395203-85395225 CTGGAGGATCACATGAGCCTGGG + Intronic
959910942 3:111763008-111763030 TTGCAGGTGCAGAAGAGGGTGGG - Intronic
960804009 3:121565335-121565357 CTGAAAGTTCAGGAGAGGCTGGG + Intergenic
961522566 3:127475511-127475533 GTGCAGCTGCAGATGGGGCTGGG - Intergenic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
962369542 3:134809737-134809759 CTGCATGCTCAGATAAGGCAGGG - Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
964470997 3:157055472-157055494 CTGGAGGATCACTTGAGGCTGGG + Intergenic
965581063 3:170268251-170268273 CTGCCGGATCAGTTGAGGCCAGG + Intronic
966809562 3:183831453-183831475 CTGGAGTTTCAGATGAGGGCTGG - Intronic
967283351 3:187843885-187843907 CTGGTAGGTCAGATGAGGCTGGG - Intergenic
967463559 3:189776044-189776066 CAGGAGGTTCAGATTAGCCTAGG + Intronic
967823024 3:193855857-193855879 GGGCAGATTCAGATGAAGCTGGG + Intergenic
968678114 4:1896572-1896594 CAGCAGTTTGAGATGAGCCTGGG - Intronic
969868978 4:10093214-10093236 GTACAGGGTCAGCTGAGGCTGGG - Intronic
970547907 4:17148439-17148461 CTTCAGATTCAGATGAGCTTAGG - Intergenic
971301589 4:25446550-25446572 CTGAGGGTGCAGATGAGGCAGGG + Intergenic
972463453 4:39328843-39328865 CTGCAGTTTCAGATGAGATACGG + Intronic
973176548 4:47212848-47212870 CTGCAGGTTCAGACTAGGGAGGG - Intronic
975487498 4:74950295-74950317 CTGGAGCTTCAGAGGAGGCATGG - Intronic
977816351 4:101417354-101417376 CTGCAGGTGCAGGTGTGCCTGGG + Intronic
981098971 4:140810354-140810376 TTGCTGTTCCAGATGAGGCTAGG - Intergenic
982245760 4:153348736-153348758 CTGGAGGATCACTTGAGGCTGGG - Intronic
984293265 4:177822239-177822261 CTCCAGCCTCAGATGGGGCTTGG + Intronic
984966797 4:185146453-185146475 GTGCAGGATCATCTGAGGCTCGG + Intronic
985905464 5:2831588-2831610 CTGCAGGTGCAGACGTGGCAGGG + Intergenic
986611579 5:9573181-9573203 CTGGAGGATCACATGAGGCCAGG + Intergenic
986912049 5:12569864-12569886 CCGCAGTTTGAGATGAGCCTGGG + Intergenic
989374843 5:40750145-40750167 CTGAAGGTTCAGATGATCATTGG - Intronic
990494220 5:56330961-56330983 CTGCAGATTCAGATGTGGGAGGG + Intergenic
994919905 5:106030822-106030844 CAGGAGTTTCAGATGAGCCTGGG + Intergenic
995064963 5:107851251-107851273 CTGCAGGTTAAAATGTGGATTGG + Intergenic
995150035 5:108832360-108832382 ATGCAGGTTAAGATGTGGATGGG + Intronic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
997580029 5:135011380-135011402 CTTCAGAGCCAGATGAGGCTGGG - Intronic
997844871 5:137277240-137277262 CAGGAGGATCACATGAGGCTAGG - Intronic
998226364 5:140329802-140329824 CTGCAGGTTCAGAGGCTCCTAGG + Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999632224 5:153583004-153583026 CAGGAGTTTGAGATGAGGCTGGG - Intronic
1001419010 5:171572880-171572902 CTGCAGGTCCAGAGGAGGCATGG - Intergenic
1001982590 5:176047042-176047064 CTGCAGGTGCACATCAGGCTGGG - Intergenic
1002098549 5:176846132-176846154 CTGGAGGTCCTGATGAGGATGGG + Intronic
1002234872 5:177797015-177797037 CTGCAGGTGCACATCAGGCTGGG + Intergenic
1004047216 6:12037940-12037962 CAGGAGGTTCACTTGAGGCTGGG - Intronic
1004641491 6:17520474-17520496 CTGGAGGTTCAGGAGAGGCTAGG - Intronic
1006387495 6:33739453-33739475 CTGGAGCTTCAGCTGGGGCTGGG + Intronic
1007186344 6:39975519-39975541 CTGATGGTTCTGATGATGCTAGG - Intergenic
1008493669 6:52111429-52111451 CAGCAGTTTCAGATCAGCCTGGG - Intergenic
1012467836 6:99535387-99535409 CAGTAGGATCAGTTGAGGCTAGG - Intergenic
1012495888 6:99832899-99832921 CTGGAGGATCACTTGAGGCTAGG + Intergenic
1013045632 6:106482108-106482130 CTGCAGTTTCATCTGAGGCTTGG + Intergenic
1015013649 6:128382665-128382687 CTGGAGGATCACTTGAGGCTAGG - Intronic
1015758070 6:136628338-136628360 CAGCAGGATCAGTTGAGGCCAGG - Intronic
1016023016 6:139255553-139255575 CTGCAGGCTCAGGTGAGGCCAGG - Exonic
1017115567 6:150973306-150973328 AGTCAGGATCAGATGAGGCTTGG + Intronic
1017515633 6:155153377-155153399 CTGGAGGTTCATTTGAGGCCAGG + Intronic
1018164090 6:161077542-161077564 CTGCAGGTGGAGAGTAGGCTGGG + Intronic
1018688634 6:166324399-166324421 CTGCAGGGTCAGAGGAGGGGAGG - Intronic
1019340775 7:507831-507853 CTCCAGGTCCAGGTGTGGCTGGG - Intronic
1019501265 7:1365988-1366010 CTGCAGGTCCAGTTCAGCCTGGG + Intergenic
1019575836 7:1737236-1737258 CTGCAGGGAAAGAGGAGGCTTGG - Intronic
1019643605 7:2117457-2117479 CTACAGTTTCAGATGAGATTTGG - Intronic
1019906514 7:4069118-4069140 CTCTAGCCTCAGATGAGGCTGGG + Intronic
1020270737 7:6593857-6593879 CAGCAGTTCCAGATGAGCCTGGG - Intronic
1020502347 7:8939163-8939185 CACAAGGTTCAGGTGAGGCTGGG + Intergenic
1020879296 7:13738901-13738923 CAGCAGGCTTAGCTGAGGCTGGG - Intergenic
1021553995 7:21901165-21901187 CTGAAGGTCCAGATGTAGCTGGG - Exonic
1022690225 7:32642893-32642915 CTGAAGGTTCAGATGATCGTTGG + Intergenic
1023340198 7:39211696-39211718 TTCCAGGTTCCAATGAGGCTGGG - Intronic
1023796924 7:43801203-43801225 CAGGAGTTTGAGATGAGGCTGGG - Intronic
1023823602 7:43993928-43993950 CTGGAGGATCATATGAGGCCAGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026646096 7:72170208-72170230 GAGCAGGATCACATGAGGCTAGG - Intronic
1026764641 7:73152941-73152963 CTGGAGGATCACTTGAGGCTGGG + Intergenic
1026795767 7:73365091-73365113 CTGAAAGTGCAGCTGAGGCTGGG + Intergenic
1027041111 7:74962709-74962731 CTGGAGGATCACTTGAGGCTGGG + Intergenic
1027082526 7:75239664-75239686 CTGGAGGATCACTTGAGGCTGGG - Intergenic
1027175388 7:75899854-75899876 CTGCAGGGTGGGATGAGGGTGGG - Intronic
1028390086 7:90306033-90306055 CTGGAGGATCAAATGAGCCTGGG - Intronic
1028843887 7:95458759-95458781 CTGGAGTTTAAGATGAGCCTTGG - Intergenic
1030273191 7:107692042-107692064 CTCCAGGCTCAAATGAGGCATGG + Intronic
1032020133 7:128403102-128403124 GGGCAGGTTCAGAAGAGGCCTGG - Intronic
1032068970 7:128792112-128792134 CAGCGGGTTCTGAGGAGGCTGGG + Exonic
1032281715 7:130508580-130508602 CTGGAGTTCCAGATGAGGATGGG - Exonic
1033150493 7:138910604-138910626 CTGGAGTTTGAGATGAGCCTGGG - Intronic
1033521406 7:142164724-142164746 CTGCAGTTTCAAATGTTGCTAGG - Intronic
1035228382 7:157445883-157445905 GTCAAGCTTCAGATGAGGCTGGG + Intergenic
1035310243 7:157963177-157963199 CTGCAGGTCCACCTGAGGCCAGG - Intronic
1035555155 8:562403-562425 CTTCAGGTTCCAAAGAGGCTGGG + Intergenic
1035566803 8:646710-646732 GTGCAGGTGCAGGGGAGGCTGGG - Intronic
1035743374 8:1945137-1945159 CAGCAGGTTCTGATGGGCCTGGG + Intronic
1035920788 8:3673907-3673929 CAGCAGTTTCAGACGAGCCTGGG + Intronic
1038209881 8:25506846-25506868 CTGCAGGGTCAGAGCAGGTTTGG - Exonic
1038753327 8:30316875-30316897 CTGCAGCAACAGATTAGGCTTGG + Intergenic
1040587417 8:48756749-48756771 TTGCAGTTTCAGATGAGGTCAGG + Intergenic
1042516348 8:69663108-69663130 CTCCAGGTTGAGGTGGGGCTGGG - Intergenic
1045287142 8:100801668-100801690 CTGCAATTTCATATGAGGCTTGG - Intergenic
1045300890 8:100908792-100908814 CTCCAGGTTCTGATGAAGCGTGG + Intergenic
1046163907 8:110403782-110403804 CTGGAGGATCACATGAGGCCAGG + Intergenic
1047520203 8:125590143-125590165 CAGCAGGCTCAGAGGAGCCTTGG - Intergenic
1047607532 8:126489862-126489884 CTGCAGACTCAGAAGAGACTTGG - Intergenic
1049014412 8:139909371-139909393 CTGCAGGTTCAGAGGCCACTGGG - Intronic
1050027663 9:1352409-1352431 TGGCAGGTTCACATGAGCCTTGG - Intergenic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1056164301 9:83926614-83926636 CAGCAGGATCACTTGAGGCTAGG - Intergenic
1059206314 9:112469568-112469590 TGGGAGGTTCAGATGAGCCTGGG + Intronic
1060638976 9:125222897-125222919 CTGAAGGATCACTTGAGGCTAGG - Intronic
1060818549 9:126648693-126648715 CTTCAGGTGAAGATGAGGCCTGG + Intronic
1061448127 9:130653260-130653282 CAGCAGGATCACTTGAGGCTAGG + Intergenic
1061920013 9:133777591-133777613 CTGCCGGGTCAGCTGAGGTTGGG - Intronic
1061937327 9:133865027-133865049 CTGCAGGTTCAGCAGAGGATAGG + Intronic
1062135099 9:134922630-134922652 CTGCAGCCTGAGATGAGCCTTGG + Intergenic
1185702728 X:2243291-2243313 CCGCAGGTACAGATGCTGCTGGG - Intronic
1185970203 X:4654225-4654247 CTGGAGTTTCAGATCAGCCTGGG + Intergenic
1186085745 X:5988767-5988789 CTTAAGGTTTAGTTGAGGCTGGG + Intronic
1189168466 X:38885449-38885471 CTGCTGATTCATAAGAGGCTTGG - Intergenic
1189860287 X:45264531-45264553 CTGCAGGATCAGCTGATGCTGGG + Intergenic
1194198047 X:90920368-90920390 CTGCAGCTTCAAGGGAGGCTGGG - Intergenic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1195143397 X:101987117-101987139 CTGGAGGATCACATGAGGCCAGG + Intergenic
1198640573 X:138751391-138751413 AGGCAGGTTCTGATGAGGGTGGG + Intronic
1198845904 X:140910187-140910209 CTGGAGATTCAGATGAGAGTTGG - Intergenic
1200543693 Y:4492463-4492485 CTGCAGCTTCAAGGGAGGCTGGG + Intergenic
1200894982 Y:8365951-8365973 CAGCAGATTCAGAGGAGACTAGG - Intergenic
1201861669 Y:18604550-18604572 CAGCAGTTTGAGATGAGCCTGGG + Intergenic
1201871654 Y:18715830-18715852 CAGCAGTTTGAGATGAGCCTGGG - Intergenic