ID: 939256690

View in Genome Browser
Species Human (GRCh38)
Location 2:139752895-139752917
Sequence ATAGCTTACTAGTACTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939256686_939256690 26 Left 939256686 2:139752846-139752868 CCTCCAATTTCATCCATGTTGTT 0: 9
1: 156
2: 1261
3: 3479
4: 7319
Right 939256690 2:139752895-139752917 ATAGCTTACTAGTACTCCATTGG No data
939256689_939256690 13 Left 939256689 2:139752859-139752881 CCATGTTGTTGCAAATAACTGGA 0: 14
1: 213
2: 1101
3: 2185
4: 3576
Right 939256690 2:139752895-139752917 ATAGCTTACTAGTACTCCATTGG No data
939256687_939256690 23 Left 939256687 2:139752849-139752871 CCAATTTCATCCATGTTGTTGCA 0: 10
1: 213
2: 1585
3: 4209
4: 16957
Right 939256690 2:139752895-139752917 ATAGCTTACTAGTACTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939256690 Original CRISPR ATAGCTTACTAGTACTCCAT TGG Intergenic
No off target data available for this crispr