ID: 939258911

View in Genome Browser
Species Human (GRCh38)
Location 2:139781648-139781670
Sequence TTCCCTTCCTACTGAAACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939258911_939258916 16 Left 939258911 2:139781648-139781670 CCCGAGTTTCAGTAGGAAGGGAA No data
Right 939258916 2:139781687-139781709 TAAAATCAGCTGTGTCTTCAAGG No data
939258911_939258918 20 Left 939258911 2:139781648-139781670 CCCGAGTTTCAGTAGGAAGGGAA No data
Right 939258918 2:139781691-139781713 ATCAGCTGTGTCTTCAAGGAGGG No data
939258911_939258917 19 Left 939258911 2:139781648-139781670 CCCGAGTTTCAGTAGGAAGGGAA No data
Right 939258917 2:139781690-139781712 AATCAGCTGTGTCTTCAAGGAGG No data
939258911_939258915 -10 Left 939258911 2:139781648-139781670 CCCGAGTTTCAGTAGGAAGGGAA No data
Right 939258915 2:139781661-139781683 AGGAAGGGAATTAGGTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939258911 Original CRISPR TTCCCTTCCTACTGAAACTC GGG (reversed) Intergenic
No off target data available for this crispr