ID: 939265852

View in Genome Browser
Species Human (GRCh38)
Location 2:139871998-139872020
Sequence TTAGGCAGATAGGAAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939265846_939265852 21 Left 939265846 2:139871954-139871976 CCTTTTGGAGGTATTTCTGTGAT No data
Right 939265852 2:139871998-139872020 TTAGGCAGATAGGAAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939265852 Original CRISPR TTAGGCAGATAGGAAAAAAG GGG Intergenic
No off target data available for this crispr