ID: 939271863

View in Genome Browser
Species Human (GRCh38)
Location 2:139949418-139949440
Sequence TCACGTCATCAGTGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939271859_939271863 -4 Left 939271859 2:139949399-139949421 CCTTCCAGTGTGGAGGGGCTCAC No data
Right 939271863 2:139949418-139949440 TCACGTCATCAGTGGGCAGAAGG No data
939271860_939271863 -8 Left 939271860 2:139949403-139949425 CCAGTGTGGAGGGGCTCACGTCA No data
Right 939271863 2:139949418-139949440 TCACGTCATCAGTGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939271863 Original CRISPR TCACGTCATCAGTGGGCAGA AGG Intergenic
No off target data available for this crispr