ID: 939273672

View in Genome Browser
Species Human (GRCh38)
Location 2:139971552-139971574
Sequence TTATGCCCTCCTCTCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939273672_939273678 18 Left 939273672 2:139971552-139971574 CCACCCTGGAGAGGAGGGCATAA No data
Right 939273678 2:139971593-139971615 CCTGCTGATCCTAGAGCACTAGG No data
939273672_939273679 19 Left 939273672 2:139971552-139971574 CCACCCTGGAGAGGAGGGCATAA No data
Right 939273679 2:139971594-139971616 CTGCTGATCCTAGAGCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939273672 Original CRISPR TTATGCCCTCCTCTCCAGGG TGG (reversed) Intergenic
No off target data available for this crispr