ID: 939273679

View in Genome Browser
Species Human (GRCh38)
Location 2:139971594-139971616
Sequence CTGCTGATCCTAGAGCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939273672_939273679 19 Left 939273672 2:139971552-139971574 CCACCCTGGAGAGGAGGGCATAA No data
Right 939273679 2:139971594-139971616 CTGCTGATCCTAGAGCACTAGGG No data
939273673_939273679 16 Left 939273673 2:139971555-139971577 CCCTGGAGAGGAGGGCATAAACC No data
Right 939273679 2:139971594-139971616 CTGCTGATCCTAGAGCACTAGGG No data
939273674_939273679 15 Left 939273674 2:139971556-139971578 CCTGGAGAGGAGGGCATAAACCT No data
Right 939273679 2:139971594-139971616 CTGCTGATCCTAGAGCACTAGGG No data
939273676_939273679 -5 Left 939273676 2:139971576-139971598 CCTGACTGGATTCACTACCTGCT No data
Right 939273679 2:139971594-139971616 CTGCTGATCCTAGAGCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939273679 Original CRISPR CTGCTGATCCTAGAGCACTA GGG Intergenic
No off target data available for this crispr