ID: 939289873

View in Genome Browser
Species Human (GRCh38)
Location 2:140180294-140180316
Sequence GGCCTCTAAGAGGCTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939289873_939289877 5 Left 939289873 2:140180294-140180316 CCTCTCACAGCCTCTTAGAGGCC No data
Right 939289877 2:140180322-140180344 CAGTTACTGTGTTAGCTGAGTGG No data
939289873_939289878 21 Left 939289873 2:140180294-140180316 CCTCTCACAGCCTCTTAGAGGCC No data
Right 939289878 2:140180338-140180360 TGAGTGGAATTGACTGTTTCAGG No data
939289873_939289879 22 Left 939289873 2:140180294-140180316 CCTCTCACAGCCTCTTAGAGGCC No data
Right 939289879 2:140180339-140180361 GAGTGGAATTGACTGTTTCAGGG No data
939289873_939289880 26 Left 939289873 2:140180294-140180316 CCTCTCACAGCCTCTTAGAGGCC No data
Right 939289880 2:140180343-140180365 GGAATTGACTGTTTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939289873 Original CRISPR GGCCTCTAAGAGGCTGTGAG AGG (reversed) Intergenic
No off target data available for this crispr