ID: 939292313

View in Genome Browser
Species Human (GRCh38)
Location 2:140212130-140212152
Sequence CAACCTCCTGTCTCATCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939292311_939292313 -9 Left 939292311 2:140212116-140212138 CCTGTATCTTGTGCCAACCTCCT 0: 133
1: 359
2: 567
3: 585
4: 500
Right 939292313 2:140212130-140212152 CAACCTCCTGTCTCATCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939292313 Original CRISPR CAACCTCCTGTCTCATCCTG TGG Intergenic
No off target data available for this crispr