ID: 939293032

View in Genome Browser
Species Human (GRCh38)
Location 2:140219878-140219900
Sequence ATCCTGTCCATTATAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939293032_939293040 14 Left 939293032 2:140219878-140219900 CCACCCACTATAATGGACAGGAT No data
Right 939293040 2:140219915-140219937 GGATATTTGTATTTATTAACAGG No data
939293032_939293036 -10 Left 939293032 2:140219878-140219900 CCACCCACTATAATGGACAGGAT No data
Right 939293036 2:140219891-140219913 TGGACAGGATTGTGGTAAATAGG No data
939293032_939293037 -9 Left 939293032 2:140219878-140219900 CCACCCACTATAATGGACAGGAT No data
Right 939293037 2:140219892-140219914 GGACAGGATTGTGGTAAATAGGG No data
939293032_939293039 -7 Left 939293032 2:140219878-140219900 CCACCCACTATAATGGACAGGAT No data
Right 939293039 2:140219894-140219916 ACAGGATTGTGGTAAATAGGGGG No data
939293032_939293038 -8 Left 939293032 2:140219878-140219900 CCACCCACTATAATGGACAGGAT No data
Right 939293038 2:140219893-140219915 GACAGGATTGTGGTAAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939293032 Original CRISPR ATCCTGTCCATTATAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr