ID: 939295000

View in Genome Browser
Species Human (GRCh38)
Location 2:140250637-140250659
Sequence ATTCTAGTCTGGAACATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939295000_939295004 20 Left 939295000 2:140250637-140250659 CCCTTTATGTTCCAGACTAGAAT No data
Right 939295004 2:140250680-140250702 AATGTTAAAATTCAGATTCTGGG No data
939295000_939295005 21 Left 939295000 2:140250637-140250659 CCCTTTATGTTCCAGACTAGAAT No data
Right 939295005 2:140250681-140250703 ATGTTAAAATTCAGATTCTGGGG No data
939295000_939295003 19 Left 939295000 2:140250637-140250659 CCCTTTATGTTCCAGACTAGAAT No data
Right 939295003 2:140250679-140250701 AAATGTTAAAATTCAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939295000 Original CRISPR ATTCTAGTCTGGAACATAAA GGG (reversed) Intronic
No off target data available for this crispr