ID: 939299970

View in Genome Browser
Species Human (GRCh38)
Location 2:140322993-140323015
Sequence AAGACTTTGGATAAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939299968_939299970 0 Left 939299968 2:140322970-140322992 CCAAATTATTGGTAAAGAGCAGC No data
Right 939299970 2:140322993-140323015 AAGACTTTGGATAAAATTTCAGG No data
939299964_939299970 28 Left 939299964 2:140322942-140322964 CCTCATATTAACCTTGGAACCTT No data
Right 939299970 2:140322993-140323015 AAGACTTTGGATAAAATTTCAGG No data
939299965_939299970 17 Left 939299965 2:140322953-140322975 CCTTGGAACCTTATATGCCAAAT No data
Right 939299970 2:140322993-140323015 AAGACTTTGGATAAAATTTCAGG No data
939299967_939299970 9 Left 939299967 2:140322961-140322983 CCTTATATGCCAAATTATTGGTA No data
Right 939299970 2:140322993-140323015 AAGACTTTGGATAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939299970 Original CRISPR AAGACTTTGGATAAAATTTC AGG Intronic
No off target data available for this crispr