ID: 939313363

View in Genome Browser
Species Human (GRCh38)
Location 2:140513734-140513756
Sequence CAACCCCTGAAATTTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939313361_939313363 14 Left 939313361 2:140513697-140513719 CCTTTCTCTATATGTTTGTGACA No data
Right 939313363 2:140513734-140513756 CAACCCCTGAAATTTAAAAGAGG No data
939313360_939313363 17 Left 939313360 2:140513694-140513716 CCGCCTTTCTCTATATGTTTGTG No data
Right 939313363 2:140513734-140513756 CAACCCCTGAAATTTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939313363 Original CRISPR CAACCCCTGAAATTTAAAAG AGG Intronic
No off target data available for this crispr