ID: 939316436

View in Genome Browser
Species Human (GRCh38)
Location 2:140556320-140556342
Sequence ACGTATAGAGTACATTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939316436_939316444 7 Left 939316436 2:140556320-140556342 CCCCCACAATGTACTCTATACGT No data
Right 939316444 2:140556350-140556372 GGGAATGTCGCACAGTGACATGG No data
939316436_939316445 28 Left 939316436 2:140556320-140556342 CCCCCACAATGTACTCTATACGT No data
Right 939316445 2:140556371-140556393 GGAGAAGAATCTGAATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939316436 Original CRISPR ACGTATAGAGTACATTGTGG GGG (reversed) Intronic
No off target data available for this crispr