ID: 939317492

View in Genome Browser
Species Human (GRCh38)
Location 2:140570163-140570185
Sequence AGGATAGAAATACTATAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939317489_939317492 25 Left 939317489 2:140570115-140570137 CCCTAAGGAACTTAAAAGCAAGA No data
Right 939317492 2:140570163-140570185 AGGATAGAAATACTATAGATTGG No data
939317490_939317492 24 Left 939317490 2:140570116-140570138 CCTAAGGAACTTAAAAGCAAGAG No data
Right 939317492 2:140570163-140570185 AGGATAGAAATACTATAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939317492 Original CRISPR AGGATAGAAATACTATAGAT TGG Intronic
No off target data available for this crispr