ID: 939325793

View in Genome Browser
Species Human (GRCh38)
Location 2:140686540-140686562
Sequence TATTACTTTTCTTCCCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939325793_939325797 2 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325797 2:140686565-140686587 TTTATTGATGAAAATAGGAGGGG No data
939325793_939325795 0 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325795 2:140686563-140686585 CTTTTATTGATGAAAATAGGAGG No data
939325793_939325794 -3 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325794 2:140686560-140686582 ATACTTTTATTGATGAAAATAGG No data
939325793_939325800 19 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325800 2:140686582-140686604 GAGGGGTTCCAATTTGAGGTGGG No data
939325793_939325799 18 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325799 2:140686581-140686603 GGAGGGGTTCCAATTTGAGGTGG No data
939325793_939325796 1 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325796 2:140686564-140686586 TTTTATTGATGAAAATAGGAGGG No data
939325793_939325798 15 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325798 2:140686578-140686600 ATAGGAGGGGTTCCAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939325793 Original CRISPR TATTACTTTTCTTCCCAGTC AGG (reversed) Intronic
No off target data available for this crispr