ID: 939325795

View in Genome Browser
Species Human (GRCh38)
Location 2:140686563-140686585
Sequence CTTTTATTGATGAAAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939325793_939325795 0 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325795 2:140686563-140686585 CTTTTATTGATGAAAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939325795 Original CRISPR CTTTTATTGATGAAAATAGG AGG Intronic
No off target data available for this crispr