ID: 939325797

View in Genome Browser
Species Human (GRCh38)
Location 2:140686565-140686587
Sequence TTTATTGATGAAAATAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939325793_939325797 2 Left 939325793 2:140686540-140686562 CCTGACTGGGAAGAAAAGTAATA No data
Right 939325797 2:140686565-140686587 TTTATTGATGAAAATAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939325797 Original CRISPR TTTATTGATGAAAATAGGAG GGG Intronic
No off target data available for this crispr