ID: 939329293

View in Genome Browser
Species Human (GRCh38)
Location 2:140737051-140737073
Sequence TCCCCCAAAAAAATAAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939329287_939329293 16 Left 939329287 2:140737012-140737034 CCAAACAAGAGTGCTGTTTAACA No data
Right 939329293 2:140737051-140737073 TCCCCCAAAAAAATAAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939329293 Original CRISPR TCCCCCAAAAAAATAAACAA GGG Intronic
No off target data available for this crispr