ID: 939334444

View in Genome Browser
Species Human (GRCh38)
Location 2:140807595-140807617
Sequence GCACTTTGTGAGCTCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939334444_939334448 8 Left 939334444 2:140807595-140807617 CCTGCCTCGAGCTCACAAAGTGC No data
Right 939334448 2:140807626-140807648 CAGATGTGAGTCACTGCTCCTGG 0: 4
1: 92
2: 1832
3: 16629
4: 56880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939334444 Original CRISPR GCACTTTGTGAGCTCGAGGC AGG (reversed) Intronic
No off target data available for this crispr