ID: 939343293

View in Genome Browser
Species Human (GRCh38)
Location 2:140928632-140928654
Sequence CAGGAAGTACAACCTTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939343287_939343293 -2 Left 939343287 2:140928611-140928633 CCCAGTCAACCACAAATGTCCCA No data
Right 939343293 2:140928632-140928654 CAGGAAGTACAACCTTACCATGG No data
939343285_939343293 12 Left 939343285 2:140928597-140928619 CCCATCTTATTGGTCCCAGTCAA No data
Right 939343293 2:140928632-140928654 CAGGAAGTACAACCTTACCATGG No data
939343284_939343293 13 Left 939343284 2:140928596-140928618 CCCCATCTTATTGGTCCCAGTCA No data
Right 939343293 2:140928632-140928654 CAGGAAGTACAACCTTACCATGG No data
939343288_939343293 -3 Left 939343288 2:140928612-140928634 CCAGTCAACCACAAATGTCCCAG No data
Right 939343293 2:140928632-140928654 CAGGAAGTACAACCTTACCATGG No data
939343286_939343293 11 Left 939343286 2:140928598-140928620 CCATCTTATTGGTCCCAGTCAAC No data
Right 939343293 2:140928632-140928654 CAGGAAGTACAACCTTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939343293 Original CRISPR CAGGAAGTACAACCTTACCA TGG Intronic
No off target data available for this crispr