ID: 939351218

View in Genome Browser
Species Human (GRCh38)
Location 2:141040522-141040544
Sequence AGGCACATACAGCAGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939351218_939351226 30 Left 939351218 2:141040522-141040544 CCTGTAATCTGCTGTATGTGCCT No data
Right 939351226 2:141040575-141040597 CTATTTCTGGAGTTCTGAAGTGG No data
939351218_939351223 2 Left 939351218 2:141040522-141040544 CCTGTAATCTGCTGTATGTGCCT No data
Right 939351223 2:141040547-141040569 CCTAGGGTTATTTAGAATAGAGG No data
939351218_939351224 17 Left 939351218 2:141040522-141040544 CCTGTAATCTGCTGTATGTGCCT No data
Right 939351224 2:141040562-141040584 AATAGAGGCTAACCTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939351218 Original CRISPR AGGCACATACAGCAGATTAC AGG (reversed) Intronic
No off target data available for this crispr