ID: 939355205

View in Genome Browser
Species Human (GRCh38)
Location 2:141092680-141092702
Sequence ACAGCTAATGAGATAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939355201_939355205 30 Left 939355201 2:141092627-141092649 CCAGTGATGGATGTAATAAAAGA No data
Right 939355205 2:141092680-141092702 ACAGCTAATGAGATAGAAACAGG No data
939355204_939355205 -1 Left 939355204 2:141092658-141092680 CCACACAGGAAGCTGTGATGGTA No data
Right 939355205 2:141092680-141092702 ACAGCTAATGAGATAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939355205 Original CRISPR ACAGCTAATGAGATAGAAAC AGG Intronic
No off target data available for this crispr