ID: 939364670

View in Genome Browser
Species Human (GRCh38)
Location 2:141216473-141216495
Sequence GCCCCACTGGGAACTCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939364670_939364673 -3 Left 939364670 2:141216473-141216495 CCACTCAGAGTTCCCAGTGGGGC No data
Right 939364673 2:141216493-141216515 GGCATTACCTAGTGAAGCTGTGG No data
939364670_939364678 4 Left 939364670 2:141216473-141216495 CCACTCAGAGTTCCCAGTGGGGC No data
Right 939364678 2:141216500-141216522 CCTAGTGAAGCTGTGGGAAGGGG No data
939364670_939364676 3 Left 939364670 2:141216473-141216495 CCACTCAGAGTTCCCAGTGGGGC No data
Right 939364676 2:141216499-141216521 ACCTAGTGAAGCTGTGGGAAGGG No data
939364670_939364674 -2 Left 939364670 2:141216473-141216495 CCACTCAGAGTTCCCAGTGGGGC No data
Right 939364674 2:141216494-141216516 GCATTACCTAGTGAAGCTGTGGG No data
939364670_939364679 5 Left 939364670 2:141216473-141216495 CCACTCAGAGTTCCCAGTGGGGC No data
Right 939364679 2:141216501-141216523 CTAGTGAAGCTGTGGGAAGGGGG No data
939364670_939364675 2 Left 939364670 2:141216473-141216495 CCACTCAGAGTTCCCAGTGGGGC No data
Right 939364675 2:141216498-141216520 TACCTAGTGAAGCTGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939364670 Original CRISPR GCCCCACTGGGAACTCTGAG TGG (reversed) Intronic
No off target data available for this crispr