ID: 939377778

View in Genome Browser
Species Human (GRCh38)
Location 2:141392086-141392108
Sequence CTGGTTAAGCTGATGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939377774_939377778 21 Left 939377774 2:141392042-141392064 CCATGGTGTTTGATGCTATGTAA No data
Right 939377778 2:141392086-141392108 CTGGTTAAGCTGATGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939377778 Original CRISPR CTGGTTAAGCTGATGAAGCA AGG Intronic
No off target data available for this crispr