ID: 939382272

View in Genome Browser
Species Human (GRCh38)
Location 2:141450993-141451015
Sequence ATGCAATCACACAGATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939382272_939382273 24 Left 939382272 2:141450993-141451015 CCTCACAATCTGTGTGATTGCAT No data
Right 939382273 2:141451040-141451062 TATAATTCCAAGACAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939382272 Original CRISPR ATGCAATCACACAGATTGTG AGG (reversed) Intronic