ID: 939392445

View in Genome Browser
Species Human (GRCh38)
Location 2:141585962-141585984
Sequence GCAACTTGGCAGACTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939392445_939392449 8 Left 939392445 2:141585962-141585984 CCTGCTTCAGTCTGCCAAGTTGC No data
Right 939392449 2:141585993-141586015 CAGATGTGAACCACAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939392445 Original CRISPR GCAACTTGGCAGACTGAAGC AGG (reversed) Intronic
No off target data available for this crispr