ID: 939392449

View in Genome Browser
Species Human (GRCh38)
Location 2:141585993-141586015
Sequence CAGATGTGAACCACAATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939392448_939392449 -6 Left 939392448 2:141585976-141585998 CCAAGTTGCTGGGATTACAGATG 0: 21
1: 2455
2: 41296
3: 178794
4: 397037
Right 939392449 2:141585993-141586015 CAGATGTGAACCACAATGCCTGG No data
939392443_939392449 15 Left 939392443 2:141585955-141585977 CCATCCTCCTGCTTCAGTCTGCC No data
Right 939392449 2:141585993-141586015 CAGATGTGAACCACAATGCCTGG No data
939392444_939392449 11 Left 939392444 2:141585959-141585981 CCTCCTGCTTCAGTCTGCCAAGT No data
Right 939392449 2:141585993-141586015 CAGATGTGAACCACAATGCCTGG No data
939392442_939392449 27 Left 939392442 2:141585943-141585965 CCTGGACTCAAGCCATCCTCCTG 0: 76
1: 1823
2: 14669
3: 56314
4: 226417
Right 939392449 2:141585993-141586015 CAGATGTGAACCACAATGCCTGG No data
939392445_939392449 8 Left 939392445 2:141585962-141585984 CCTGCTTCAGTCTGCCAAGTTGC No data
Right 939392449 2:141585993-141586015 CAGATGTGAACCACAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939392449 Original CRISPR CAGATGTGAACCACAATGCC TGG Intronic
No off target data available for this crispr