ID: 939394612

View in Genome Browser
Species Human (GRCh38)
Location 2:141612735-141612757
Sequence CTGAGTGATGCGAAGGCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939394612_939394615 2 Left 939394612 2:141612735-141612757 CCTTTCGCCTTCGCATCACTCAG No data
Right 939394615 2:141612760-141612782 TTTCCAAGGCAATAGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939394612 Original CRISPR CTGAGTGATGCGAAGGCGAA AGG (reversed) Intronic
No off target data available for this crispr