ID: 939396033

View in Genome Browser
Species Human (GRCh38)
Location 2:141630806-141630828
Sequence CAATATGCACAATTGATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939396033_939396034 -9 Left 939396033 2:141630806-141630828 CCAACTATCAATTGTGCATATTG No data
Right 939396034 2:141630820-141630842 TGCATATTGCATTATCCTTTTGG No data
939396033_939396035 -8 Left 939396033 2:141630806-141630828 CCAACTATCAATTGTGCATATTG No data
Right 939396035 2:141630821-141630843 GCATATTGCATTATCCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939396033 Original CRISPR CAATATGCACAATTGATAGT TGG (reversed) Intronic
No off target data available for this crispr