ID: 939396033 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:141630806-141630828 |
| Sequence | CAATATGCACAATTGATAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939396033_939396034 | -9 | Left | 939396033 | 2:141630806-141630828 | CCAACTATCAATTGTGCATATTG | No data | ||
| Right | 939396034 | 2:141630820-141630842 | TGCATATTGCATTATCCTTTTGG | No data | ||||
| 939396033_939396035 | -8 | Left | 939396033 | 2:141630806-141630828 | CCAACTATCAATTGTGCATATTG | No data | ||
| Right | 939396035 | 2:141630821-141630843 | GCATATTGCATTATCCTTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939396033 | Original CRISPR | CAATATGCACAATTGATAGT TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||