ID: 939396701

View in Genome Browser
Species Human (GRCh38)
Location 2:141639851-141639873
Sequence ATTTGTAACAAGAAGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939396701_939396704 5 Left 939396701 2:141639851-141639873 CCCACAACCTTCTTGTTACAAAT No data
Right 939396704 2:141639879-141639901 TGCTACAACCTTACACCCTAAGG No data
939396701_939396706 15 Left 939396701 2:141639851-141639873 CCCACAACCTTCTTGTTACAAAT No data
Right 939396706 2:141639889-141639911 TTACACCCTAAGGCCTGCCTTGG No data
939396701_939396709 27 Left 939396701 2:141639851-141639873 CCCACAACCTTCTTGTTACAAAT No data
Right 939396709 2:141639901-141639923 GCCTGCCTTGGTAAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939396701 Original CRISPR ATTTGTAACAAGAAGGTTGT GGG (reversed) Intronic
No off target data available for this crispr