ID: 939396706

View in Genome Browser
Species Human (GRCh38)
Location 2:141639889-141639911
Sequence TTACACCCTAAGGCCTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939396700_939396706 16 Left 939396700 2:141639850-141639872 CCCCACAACCTTCTTGTTACAAA No data
Right 939396706 2:141639889-141639911 TTACACCCTAAGGCCTGCCTTGG No data
939396703_939396706 8 Left 939396703 2:141639858-141639880 CCTTCTTGTTACAAATGACATTG No data
Right 939396706 2:141639889-141639911 TTACACCCTAAGGCCTGCCTTGG No data
939396702_939396706 14 Left 939396702 2:141639852-141639874 CCACAACCTTCTTGTTACAAATG No data
Right 939396706 2:141639889-141639911 TTACACCCTAAGGCCTGCCTTGG No data
939396699_939396706 17 Left 939396699 2:141639849-141639871 CCCCCACAACCTTCTTGTTACAA No data
Right 939396706 2:141639889-141639911 TTACACCCTAAGGCCTGCCTTGG No data
939396701_939396706 15 Left 939396701 2:141639851-141639873 CCCACAACCTTCTTGTTACAAAT No data
Right 939396706 2:141639889-141639911 TTACACCCTAAGGCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939396706 Original CRISPR TTACACCCTAAGGCCTGCCT TGG Intronic
No off target data available for this crispr