ID: 939396709

View in Genome Browser
Species Human (GRCh38)
Location 2:141639901-141639923
Sequence GCCTGCCTTGGTAAACTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939396700_939396709 28 Left 939396700 2:141639850-141639872 CCCCACAACCTTCTTGTTACAAA No data
Right 939396709 2:141639901-141639923 GCCTGCCTTGGTAAACTCACAGG No data
939396705_939396709 -9 Left 939396705 2:141639887-141639909 CCTTACACCCTAAGGCCTGCCTT No data
Right 939396709 2:141639901-141639923 GCCTGCCTTGGTAAACTCACAGG No data
939396703_939396709 20 Left 939396703 2:141639858-141639880 CCTTCTTGTTACAAATGACATTG No data
Right 939396709 2:141639901-141639923 GCCTGCCTTGGTAAACTCACAGG No data
939396701_939396709 27 Left 939396701 2:141639851-141639873 CCCACAACCTTCTTGTTACAAAT No data
Right 939396709 2:141639901-141639923 GCCTGCCTTGGTAAACTCACAGG No data
939396699_939396709 29 Left 939396699 2:141639849-141639871 CCCCCACAACCTTCTTGTTACAA No data
Right 939396709 2:141639901-141639923 GCCTGCCTTGGTAAACTCACAGG No data
939396702_939396709 26 Left 939396702 2:141639852-141639874 CCACAACCTTCTTGTTACAAATG No data
Right 939396709 2:141639901-141639923 GCCTGCCTTGGTAAACTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939396709 Original CRISPR GCCTGCCTTGGTAAACTCAC AGG Intronic
No off target data available for this crispr