ID: 939397568

View in Genome Browser
Species Human (GRCh38)
Location 2:141650526-141650548
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939397566_939397568 6 Left 939397566 2:141650497-141650519 CCTGATTACATTTGAGTTTTTCA No data
Right 939397568 2:141650526-141650548 ACCATGGCTGCCACTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr