ID: 939399504

View in Genome Browser
Species Human (GRCh38)
Location 2:141672364-141672386
Sequence GAGTGTTCACAAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939399500_939399504 0 Left 939399500 2:141672341-141672363 CCAGGGCATTGTGCAGTAATCCA No data
Right 939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG No data
939399499_939399504 1 Left 939399499 2:141672340-141672362 CCCAGGGCATTGTGCAGTAATCC No data
Right 939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939399504 Original CRISPR GAGTGTTCACAAAGGGAAGA AGG Intronic
No off target data available for this crispr