ID: 939403363

View in Genome Browser
Species Human (GRCh38)
Location 2:141724347-141724369
Sequence CTCTTTTACCAGCAGCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939403363_939403366 19 Left 939403363 2:141724347-141724369 CCATGTAGCTGCTGGTAAAAGAG No data
Right 939403366 2:141724389-141724411 ATTGAATTTTTAAGTATGAAAGG No data
939403363_939403368 26 Left 939403363 2:141724347-141724369 CCATGTAGCTGCTGGTAAAAGAG No data
Right 939403368 2:141724396-141724418 TTTTAAGTATGAAAGGGATGTGG No data
939403363_939403367 20 Left 939403363 2:141724347-141724369 CCATGTAGCTGCTGGTAAAAGAG No data
Right 939403367 2:141724390-141724412 TTGAATTTTTAAGTATGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939403363 Original CRISPR CTCTTTTACCAGCAGCTACA TGG (reversed) Intronic
No off target data available for this crispr